‘Ορίζοντες’: Προτεινόμενα θέματα στη Βιολογία Προσανατολισμού και στην Ανάπτυξη Εφαρμογών Τεχνολογικής Κατεύθυνσης

Το Candiadoc συνεργάζεται με τον Εκπαιδευτικό Οργανισμό ‘Ορίζοντες’ για την παρουσίαση των προτεινόμενων θεμάτων για τις Πανελλαδικές Εξετάσεις, κάθε Δευτέρα και Παρασκευή.

Σήμερα τα προτεινόμενα θέματα στη Βιολογία Προσανατολισμού Γ’ Λυκείου και στην Ανάπτυξη Εφαρμογών Τεχνολογικής Κατεύθυνσης Γ’ Λυκείου.

ΒΙΟΛΟΓΙΑ  ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ΄ ΛΥΚΕΙΟΥ

 

  1. Να επιλέξετε τη σωστή απάντηση.

Α. Περιπτώσεις που εμφανίζεται πρόβλημα στην λειτουργία των πνευμόνων αποτελούν οι ασθενείς που πάσχουν από :

α. κυστική ίνωση και έλλειψη ADA

β. έλλειψη ΑΑΤ και ΑDA

γ. κυστική ίνωση και έλλειψη ΑΑΤ

δ. PKU και αλφισμό

Β. Κατά τη διάρκεια της μετάφρασης, σε δυο ριβοσώματα συνδεδεμένα στο ίδιο μόριο mRNAέχει συντεθεί διαφορετική αλληλουχία αμινοξέων, αυτό μπορεί να συμβαίνει:

α. στο κυτταρόπλασμα προκαρωτικού κυττάρου

β. στο κυτταρόπλασμα ευκαρυωτικού κυττάρου

γ. και στα δυο

δ. σε καμία περίπτωση

Γ. Μια οικογένεια έχει 3 αγόρια. Ποια η πιθανότητα το τέταρτο παιδί τους να είναι αγόρι;

α. 0%

β. 25%

γ. 50%

δ. 75%

Δ. Αν σε ένα ανθρώπινο σωματικό κύτταρο που μπαίνει στη διαδικασία της μείωσης συμβεί μη διαχωρισμός σε ζεύγος ομόλογων χρωμοσωμάτων στη 1η μειωτική διαίρεση, προκύπτουν:

α. δύο γαμέτες με 23, ένας με 22 και ένας με 24 χρωμοσώματα

β. δύο γαμέτες με 22 και δύο με 24 χρωμοσώματα

γ. δύο γαμέτες με 21 και δύο με 25 χρωμοσώματα

δ. δύο γαμέτες με 22, ένας με 21 και ένας με 25 χρωμοσώματα

Ε. Το γενετικό υλικό των χλωροπλαστών είναι

α. δίκλωνο γραμμικό DNA

β. δίκλωνο κυκλικό RNA

γ. δίκλωνο κυκλικό DNA

δ. δίκλωνο, κυκλικό ή γραμμικό DNA

  1. Τι είναι οι ιντερφερόνες και ποια βήματα θα ακολουθούσατε για να τις παράγετε από βακτήρια (συνοπτικά);
  2. Έχετε εισάγει ένα ανθρώπινο γονίδιο σε βακτηριακά κύτταρα με τις τεχνικές του ανασυνδυασμένου DNA και παράγεται μια πολυπεπτιδική αλυσίδαμε διαφορές στην αλληλουχία των αμινοξέων σε σχέση με το φυσιολογικό προϊόν που αυτό κωδικοποιεί. Αναφέρετε δυο λόγους που συμβαίνει αυτό.
  3. Το κλωνοποιημένο πρόβατο Dollyδιασταυρώθηκε με ένα αρσενικό πρόβατο και γέννησε ένα προβατάκι. Τι ομοιότητες θα έχει το DNAτου με τα πρόβατα που χρησιμοποιήθηκαν για τη δημιουργία της Dolly;
  4. Δίνεται το παρακάτω τμήμα DNAπροκαρυωτικού κυττάρου που περιέχει ένα γονίδιο:

5’GAATTCGGACTACCAAGATGCGTATGGCATCGAATTCGG 3’

3’CTTAAGCCTGATGGTTCTACGCATACCGTAGCTTAAGCC 5’

Το τμήμα αυτό κόβεται από τη περιοριστική ενδονουκλεάση EcoRI και ενσωματώνεται σε πλασμίδιο με σκοπό να εκφράσει σε βακτήριο την πρωτεΐνη που κωδικοποιεί.

α. Να γράψετε το τμήμα DNAπου απομένει μετά τη δράση της EcoRI.

β. Να προσδιορίσετε ποια είναι η κωδική και ποια η μη κωδική αλυσίδα του γονιδίου και να αιτιολογήσετε την απάντησή σας.

γ. Να γράψετε το μόριο του mRNAπου θα προκύψει από τη μεταγραφή αυτού του γονιδίου και να αιτιολογήσετε την απάντησή σας.

δ. Να γράψετε τα αντικωδικόνια των tRNA με τη σειρά που παίρνουν μέρος στη μετάφραση του παραπάνω μορίου mRNA και να αιτιολογήσετε την απάντησή σας.

ε. Από ποια αμινοξέα αποτελείται η πολυπεπτιδική αλυσίδα που σχηματίζεται από την έκφραση αυτού του γονιδίου; Πόσους πεπτιδικούς δεσμούς περιέχει; Να συμβουλευτείτε τον πίνακα με το γενετικό κώδικα.

ΑΠΑΝΤΗΣΕΙΣ

  1. Α.→ γ,  Β.→ α, Γ.→γ,   Δ. →β, Ε.→ γ
  2. Σχ. βιβλίο σελ. 123   Οι ιντερφερόνες είναι αντιικές πρωτεΐνες,…μέθοδο παραγωγής με αυτήν της ινσουλίνης.»

Βήματα :

  • Απομόνωση του συνολικού mRNA, από κύτταρα του οργανισμού που έχουν μολυνθεί από ιό.
  • Κατασκευή δίκλωνων μορίων DNAκαι ενσωμάτωσή τους σε πλασμίδια.
  • Μετασχηματισμός βακτηρίων με τα ανασυνδυασμέναπλασμίδια και πολλαπλασισμός τους σε υγρό θρεπτικό υλικό.
  • Επιλογή βακτηρίων που περιέχουν το γονίδιο το οποίο κωδικοποιεί την ιντερφερόνη.
  • Ανάπτυξη των βακτηρίων αυτών σε βιοαντιδραστήρα για παραγωγή της ιντερφερόνης. Η ιντερφερόνη συλλέγεται, καθαρίζεται και είναι έτοιμη να χρησιμοποιηθεί.
  1. Σχ. βιβλίο σελ. 37 «Τα περισσότερα γονίδια των ευκαρυωτικών οργανισμών (και των ιών που τους προσβάλλουν) είναι ασυνεχή ή διακεκομμένα…αυτές ονομάζονται 5’ και 3’ αμετάφραστες περιοχές, αντίστοιχα.»  τα βακτήρια δεν διαθέτουν τέτοια γονίδια και συνεπώς δεν έχουν μηχανισμούς ωρίμανσης mRNA.

Σχ. βιβλίο σελ. 46. «Ακόμη και όταν γίνει η πρωτεϊνοσύνθεση… βιολογικά λειτουργική». Τα βακτήρια δεν διαθέτουν τους μηχανισμούς τροποποίησης πρωτεϊνών που διαθέτουν οι ευκαρυωτικοί οργανισμοί.

  1. Σχ. βιβλίο σελ. 142 «Το πρόβατο Dollyδημιουργήθηκε, όταν ο πυρήνας… η οποία γέννησε την Dolly». Το πυρηνικό DNAτης Dollyείναι 100% όμοιο με το πρόβατο από το οποίο απομονώθηκε ο πυρήνας του κυττάρου μαστικού αδένα και το μιτοχονδριακό της DNA όμοιο με το πρόβατο από το οποίο απομονώθηκε το ωάριο. Ο απόγονος της Dolly προέκυψε από τη γονιμοποίηση ενός ωάριου της Dollyκαι ενός σπερματοζωαρίου του αρσενικού προβάτου, τα οποία είναι απλοειδή κύτταρα και περιέχουν τη μισή ποσότητα γενετικού υλικού από τα σωματικά κύτταρα που είναι διπλοειδή. Σχ. βιβλίο σελ. 25 « Το ζυγωτό των ανώτερων οργανισμών περιέχει μόνο τα μιτοχόνδρια που προέρχονται από το ωάριο. Επομένως, η προέλευση των μιτοχονδριακών γονιδίων είναι μητρική.»

Άρα το προβατάκι θα έχει πυρηνικόDNA50% όμοιο με το πρόβατο από το οποίο απομονώθηκε ο πυρήνας κυττάρου μαστικού αδένα και 100% όμοιο μιτοχονδριακό DNAμε το πρόβατο από το οποίο απομονώθηκε το ωάριο, ενώ με το πρόβατο που γέννησε την Dollyκαμία γενετική ομοιότητα.

  1. α. Η περιοριστική ενδονουκλεάση EcoRI όποτε συναντάει την αλληλουχία:

5’ – GAATTC- 3’

3’ – CTTAAG – 5’

κόβει κάθε αλυσίδα του δίκλωνου DNAμεταξύ του Gκαι του A(με κατεύθυνση 5’ -> 3’). Στο μόριο DNAτης άσκησης, η αλληλουχία αυτή υπάρχει 2 φορές, οπότε μετά την επίδραση της EcoRI το τμήμα του DNAπου απομένει θα είναι το

5’AATTCGGACTACCAAGATGCGTATGGCATCG 3’

3’ GCCTGATGGTTCTACGCATACCGTAGCTTAA 5’

β. Σχ. βιβλίο σελ. 37 «Το μόριο RNAπου συντίθεται… γονιδίου ονομάζεται κωδική» . Επομένως το mRNA και η κωδική αλυσίδα έχουν την ίδια αλληλουχία βάσεων, με τη μόνη διαφορά ότι όπου υπάρχει ουρακίλη στο mRNA, υπάρχει θυμίνη στην κωδική αλυσίδα αφού και οι δύο είναι συμπληρωματικές και αντιπαράλληλες με τη μη κωδική αλυσίδα του DNA. Η μεταγραφή έχει προσανατολισμό 5’ – >3’. Σύμφωνα με το γενετικό κώδικα, η μετάφραση όλων των mRNA αρχίζει από το κωδικόνιο έναρξης 5’AUG3’ και τελειώνει σε ένα από τα τρία κωδικόνια λήξης 5’UAG3’, 5’UGA3’ή 5’UAA3’. Ο όρος κωδικόνιο δεν αφορά μόνο το mRNAαλλά και το γονίδιο από το οποίο παράγεται Έτσι το αντίστοιχο κωδικόνιο έναρξηςτης κωδικής αλυσίδας του γονιδίου είναι το 5’AΤG3’, και τα κωδικόνια λήξης αντιστοιχούν στην κωδική αλυσίδα στα 5’ΤAG3’, 5’ΤGA3’ή 5’ΤAA3’. Σχ. Βιβλίο σελ. 39 «1. Ο γενετικός κώδικας είναι κώδικας τριπλέτας… ανήκει σε ένα μόνο κωδικόνιο.» Για να βρεθεί η κωδική αλυσίδα ψάχνουμε και στις δύο αλυσίδες, με κατεύθυνση 5’ -> 3’ , το κωδικόνιο έναρξης και με βήμα τριπλέτας ένα κωδικόνιο λήξης. Η αλυσίδα που εκπληρώνει τις προϋποθέσεις είναι η κάτω, συνεπώς η κάτω είναι η κωδική και η πάνω η μη κωδική.

5’AATTCGGACTACCAAGATGCGTATGGCATCG 3’

3’ GCCTGATGGTTCTACGCATACCGTAGCTTAA 5’

 

γ. Σχ. βιβλίο σελ. 36 «Κατά την έναρξη της μεταγραφής… που περιέχει ουρακίλη.», Σχ. βιβλίο σελ. 37 «Στους προκαρυωτικούς οργανισμούς… ολοκληρωθεί η μεταγραφή του.»

Επομένως το mRNA που θα προκύψει θα είναι το εξής:

5’ AAUUCGAUG-CCA-UAC-GCA-UCU-UGG-UAGUCCGAAUU 3’

δ. Σχ. βιβλίο σελ.40 «Κάθε μόριο tRNA…αντίστοιχο κωδικόνιοτουmRNA.» Τα αντικωδικόνια είναι συμπληρωματικά και αντιπαράλληλα με τα κωδικόνια του mRNA. Tο κωδικόνιο λήξης δεν αντιστοιχεί σε κάποιο tRNA. Επομένως, τα αντικωδικόνια των tRNAμε τη σειρά που συμμετέχουν στη μετάφραση είναι τα:

3’UAC 5’,3’GGU 5’, 3’AUG 5’, 3’CGU 5’, 3’AGA 5’, 3’ACC 5’.

ε. Ο γενετικός κώδικας είναι κώδικας αντιστοίχισηςκωδικονίων του mRNAμε αμινοξέα στην πολυπεπτιδική αλυσίδα. Με βάση αυτό το ολιγοπεπτίδιο που θα δημιουργηθεί θα αποτελείται από τα εξής αμινοξέα:

Η2Ν- μεθειονίνη-προλίνη-τυροσίνη-αλανίνη-σερίνη-τρυπτοφάνη-COOH. Οι πεπτιδικοί δεσμοί είναι ομοιοπολικοί δεσμοί που αναπτύσσονται μεταξύ των αμινοξέων στην πολυπεπτιδική αλυσίδα. Κατά συνέπεια, μεταξύ των 6 αμινοξέων υπάρχουν 5 πεπτιδικοί δεσμοί.

ΕΠΙΜΕΛΕΙΑ

ΟΜΑΔΑ ΒΙΟΛΟΓΩΝ Ε.Ο. ΟΡΙΖΟΝΤΕΣ

ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ΄ ΛΥΚΕΙΟΥ

ΑΣΚΗΣΗ

Ο Οργανισμός Λιμένος προκήρυξε διαγωνισμό 100 θέσεων. Οι θέσεις αφορούν διάφορα λιμάνια της χώρας. Οι υποψήφιοι διαγωνίζονται σε 4 μαθήματα και βαθμολογούνται με ακέραιους βαθμούς στην βαθμολογική κλίμακα από 1 έως 100. Στις εξετάσεις προσήλθαν 100 υποψήφιοι.

Ο υπολογισμός του τελικού βαθμού κάθε υποψηφίου γίνεται ως εξής: Αν ο βαθμός του σε κάποιο από τα τέσσερα μαθήματα είναι μικρότερος του 60, τότε ο τελικός βαθμός του είναι μηδέν (0). Διαφορετικά ο βαθμός του 1ου μαθήματος συμμετέχει στον υπολογισμό του τελικού βαθμού με συντελεστή 20%, ο βαθμός του 2ου μαθήματος με συντελεστή 30%, ο βαθμός του 3ου μαθήματος με συντελεστή 15% και ο βαθμός του 4ου μαθήματος με συντελεστή 35%.

Για κάθε υποψήφιο, η Υγειονομική επιτροπή έθεσε περιορισμό ως προς τον δείκτη μάζας σώματος. Αποδεκτές τιμές είναι από 20 έως και 25. Σε διαφορετική περίπτωση ο υποψήφιος απορρίπτεται. Ο Δείκτης Μάζας Σώματος μετρά την αναλογία του λίπους στο σώμα σας προς το συνολικό βάρος και υπολογίζεται διαιρώντας το βάρος με το τετράγωνο του ύψους.

Να κατασκευάσετε πρόγραμμα στη ΓΛΩΣΣΑ το οποίο :

  1. Να διαβάζει τα ονόματα, το βάρος (σε κιλά) και το ύψος  των υποψηφίων και να τα αποθηκεύει σε μονοδιάστατους πίνακες.
  2. Να διαβάζει τους βαθμούς που έλαβε κάθε υποψήφιος στα μαθήματα που εξετάστηκε και να τους αποθηκεύει σε δισδιάστατο πίνακα ΒΑΘ[100,5] , στις 4 πρώτες στήλες και στη συνέχεια να υπολογίζει τον τελικό βαθμό κάθε υποψηφίου αποθηκεύοντας τον στην 5η στήλη του πινάκα ΒΑΘ
  3. Να υπολογίζει με τη χρήση υποπρογράμματος το μάθημα το οποίο δυσκόλεψε περισσότερο τους υποψηφίους  συγκεντρώνοντας το χαμηλότερο σύνολο βαθμολογιών και να εμφανίζεται η χαμηλότερη βαθμολογία καθώς και το μάθημα. Για τον σκοπό αυτόν, να καλεί το υποπρόγραμμα ΧΑΜΗΛΟΤΕΡΗ_ΒΑΘΜΟΛΟΓΙΑ , που περιγράφεται στο ερώτημα 8.
  4. Για κάθε υποψήφιο να ελέγχει εάν έχει αποδεκτή τιμή στον δείκτη μάζας σώματος και να εισάγει σε πίνακα μονοδιάστατο ΔΜΣ την πληροφορία που αφορά την αποδοχή του υποψηφίου (καταχωρούμε την τιμή 1 στην περίπτωση που είναι εντός ορίων και την τιμή 0 σε διαφορετική περίπτωση). Για τον σκοπό αυτόν, να καλεί το υποπρόγραμμα ΑΠΟΔΕΚΤΟΣ, που περιγράφεται στο ερώτημα 7.
  5. Να δημιουργεί δύο μονοδιάστατους πίνακες με τα ονόματα και τις βαθμολογίες των υποψηφίων που έχουν τα προσόντα για τον διαγωνισμό (δηλαδή αποδεκτή τιμή στον ΔΜΣ και τελικό βαθμό πάνω από 80).
  6. Να εμφανίζει τη λίστα των επιτυχόντων,  ταξινομημένων κατά βαθμολογία και σε περίπτωση ισοβαθμίας η ταξινόμηση να είναι αλφαβητική. Σε περίπτωση που δεν καλυφθούν όλες οι θέσεις να εμφανίζει μήνυμα με τις εναπομείναντες θέσεις.
  7. Να κατασκευάσετε κατάλληλο υποπρόγραμμα ΑΠΟΔΕΚΤΟΣ, το οποίο θα δέχεται το ύψος και το βάρος ενός υποψηφίου, θα υπολογίζει τον δείκτη μάζας σώματος και θα επιστρέφει την τιμή ΑΛΗΘΗΣ, αν ο δείκτης ανήκει στο διάστημα [20,25] και την τιμή ΨΕΥΔΗΣ σε κάθε άλλη περίπτωση.
  8. Να κατασκευάσετε κατάλληλο υποπρόγραμμα ΧΑΜΗΛΟΤΕΡΗ_ΒΑΘΜΟΛΟΓΙΑ το οποίο θα δέχεται τον πίνακα με τις βαθμολογίες των υποψηφίων σε κάθε ένα από τα 4 μαθήματα, και θα υπολογίζει το μάθημα το οποίο δυσκόλεψε περισσότερο τους υποψηφίους  συγκεντρώνοντας το χαμηλότερο σύνολο βαθμολογιών. Το υποπρόγραμμα θα επιστρέφει τον αριθμό του μαθήματος καθώς και τη μικρότερη συνολική βαθμολογία. Θεωρείστε ότι δεν υπάρχουν ισοβαθμίες.

 

ΑΠΑΝΤΗΣΗ

ΠΡΟΓΡΑΜΜΑ ΛΙΜΕΝΙΚΟ

ΜΕΤΑΒΛΗΤΕΣ

 ΑΚΕΡΑΙΕΣ: i,j, ΔΜΣ[100],Κ, ΘΕΣΗ

 ΠΡΑΓΜΑΤΙΚΕΣ: ΒΑΡΟΣ[100],ΥΨΟΣ[100],ΒΑΘ[100,5],ΒΑΘ_ΕΠ[100], temp, ΜΙΝ

 ΧΑΡΑΚΤΗΡΕΣ: ΟΝ[100], ΟΝ_ΕΠ[100], temp1

 ΛΟΓΙΚΕΣ: ΑΠΟΤ

ΑΡΧΗ

 ΓΙΑ i ΑΠΟ 1 ΜΕΧΡΙ 100

   ΔΙΑΒΑΣΕ ΒΑΡΟΣ[i], ΥΨΟΣ[i],ΟΝ[i]

 ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

 ΓΙΑ i ΑΠΟ 1 ΜΕΧΡΙ 100

   ΓΙΑ j ΑΠΟ 1 ΜΕΧΡΙ 4

     ΑΡΧΗ_ΕΠΑΝΑΛΗΨΗΣ

       ΔΙΑΒΑΣΕ ΒΑΘ[i,j]

     ΜΕΧΡΙΣ_ΟΤΟΥ ΒΑΘ[i,j]>= 1 ΚΑΙ ΒΑΘ[i,j]<=100

   ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

 ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

 ΓΙΑ i ΑΠΟ 1 ΜΕΧΡΙ 100

   ΑΝ ΒΑΘ[i,1]< 60 Ή ΒΑΘ[i,2]< 60 Ή ΒΑΘ[i,3]<60 Ή ΒΑΘ[i,4]<60 ΤΟΤΕ

     ΒΑΘ[i,5] <– 0

   ΑΛΛΙΩΣ

     ΒΑΘ[i,5] <– ΒΑΘ[i,1]*0.20 + ΒΑΘ[i,2]*0.30 + ΒΑΘ[i,3]*0.15+ ΒΑΘ[i,4]*0.35

   ΤΕΛΟΣ_ΑΝ

 ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

 ΚΑΛΕΣΕ  ΧΑΜΗΛΟΤΕΡΗ_ΒΑΘΜΟΛΟΓΙΑ(ΒΑΘ, ΘΕΣΗ, ΜΙΝ)

 ΓΡΑΨΕ ‘ΤΟ ΜΑΘΗΜΑ ΠΟΥ ΣΥΓΚΕΝΤΡΩΣΕ ΤΗ ΧΑΜΗΛΟΤΕΡΗ ΒΑΘΜΟΛΟΓΙΑ ΕΙΝΑΙ: ‘, ΘΕΣΗ

 ΓΡΑΨΕ ‘Η ΧΑΜΗΛΟΤΕΡΗ ΒΑΘΜΟΛΟΓΙΑ ΕΙΝΑΙ:’, ΜΙΝ

 ΓΙΑ i ΑΠΟ 1 ΜΕΧΡΙ 100

   ΑΠΟΤ <– ΑΠΟΔΕΚΤΟΣ(ΒΑΡΟΣ[i],ΥΨΟΣ[i])

   ΑΝ ΑΠΟΤ = ΑΛΗΘΗΣ ΤΟΤΕ

     ΔΜΣ[i] <– 1

   ΑΛΛΙΩΣ

     ΔΜΣ[i] <– 0

   ΤΕΛΟΣ_ΑΝ

 ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

 Κ <– 0

 ΓΙΑ i ΑΠΟ 1 ΜΕΧΡΙ 100

   ΑΝ ΔΜΣ[i] = 1 ΚΑΙ ΒΑΘ[i,5] > 80 ΤΟΤΕ

     Κ <– Κ +1

     ΟΝ_ΕΠ[Κ] <– ΟΝ[i]

     ΒΑΘ_ΕΠ[Κ] <– ΒΑΘ[i,5]

   ΤΕΛΟΣ_ΑΝ

 ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

 ΓΙΑ i ΑΠΟ 2 ΜΕΧΡΙ Κ

   ΓΙΑ j ΑΠΟ Κ ΜΕΧΡΙ i ΜΕ ΒΗΜΑ -1

     ΑΝ ΒΑΘ_ΕΠ[j-1] < ΒΑΘ_ΕΠ[j] ΤΟΤΕ

       temp <– ΒΑΘ_ΕΠ[j-1]

       ΒΑΘ_ΕΠ[j-1] <– ΒΑΘ_ΕΠ[j]

       ΒΑΘ_ΕΠ[j] <– temp

       temp1 <– ΟΝ_ΕΠ[j-1]

       ΟΝ_ΕΠ[j-1] <– ΟΝ_ΕΠ[j]

       ΟΝ_ΕΠ[j] <– temp1

     ΑΛΛΙΩΣ_ΑΝ ΒΑΘ_ΕΠ[j-1] = ΒΑΘ_ΕΠ[j] ΤΟΤΕ

       temp1 <– ΟΝ_ΕΠ[j-1]

       ΟΝ_ΕΠ[j-1] <– ΟΝ_ΕΠ[j]

       ΟΝ_ΕΠ[j] <– temp1

     ΤΕΛΟΣ_ΑΝ

   ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

 ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

 ΓΡΑΨΕ ‘ΕΠΙΤΥΧΟΝΤΕΣ ΕΙΝΑΙ ΟΙ:’

 ΓΙΑ i ΑΠΟ 1 ΜΕΧΡΙ Κ

   ΓΡΑΨΕ ΟΝ_ΕΠ[i], ΒΑΘ_ΕΠ[i]

 ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

 ΑΝ Κ < 100 ΤΟΤΕ

   ΓΡΑΨΕ ‘ΕΧΟΥΝ ΑΠΟΜΕΙΝΕΙ’, 100-Κ, ‘ΘΕΣΕΙΣ’

 ΤΕΛΟΣ_ΑΝ

ΤΕΛΟΣ_ΠΡΟΓΡΑΜΜΑΤΟΣ

ΣΥΝΑΡΤΗΣΗ ΑΠΟΔΕΚΤΟΣ(Β,Υ): ΛΟΓΙΚΗ

ΜΕΤΑΒΛΗΤΕΣ

 ΠΡΑΓΜΑΤΙΚΕΣ: Β, Υ, Δ

 ΛΟΓΙΚΕΣ: ΑΠΟΤ

ΑΡΧΗ

 Δ <– Β/(Υ^2)

 ΑΠΟΤ <– ΨΕΥΔΗΣ

 ΑΝ Δ >= 20 ΚΑΙ Δ <= 25 ΤΟΤΕ

   ΑΠΟΤ <– ΑΛΗΘΗΣ

 ΤΕΛΟΣ_ΑΝ

 ΑΠΟΔΕΚΤΟΣ <– ΑΠΟΤ

ΤΕΛΟΣ_ΣΥΝΑΡΤΗΣΗΣ

ΔΙΑΔΙΚΑΣΙΑ ΧΑΜΗΛΟΤΕΡΗ_ΒΑΘΜΟΛΟΓΙΑ(ΒΑΘ, ΘΕΣΗ, ΜΙΝ)

ΜΕΤΑΒΛΗΤΕΣ

 ΑΚΕΡΑΙΕΣ: i,j,ΘΕΣΗ

 ΠΡΑΓΜΑΤΙΚΕΣ: ΒΑΘ[100,5], ΑΘΡ[4], ΜΙΝ

ΑΡΧΗ

 ΓΙΑ j ΑΠΟ 1 ΜΕΧΡΙ 4

   ΑΘΡ[j] <– 0

   ΓΙΑ i ΑΠΟ 1 ΜΕΧΡΙ 100

     ΑΘΡ[j] <– ΑΘΡ[j] + ΒΑΘ[i,j]

   ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

 ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

 ΜΙΝ <– ΑΘΡ[1]

 ΓΙΑ j ΑΠΟ 1 ΜΕΧΡΙ 4

   ΑΝ ΑΘΡ[j]< ΜΙΝ ΤΟΤΕ

     ΜΙΝ <– ΑΘΡ[j]

     ΘΕΣΗ <– j

   ΤΕΛΟΣ_ΑΝ

 ΤΕΛΟΣ_ΕΠΑΝΑΛΗΨΗΣ

ΤΕΛΟΣ_ΔΙΑΔΙΚΑΣΙΑΣ

 

Επιμέλεια:  

Μαρία Παπαματθαιάκη, Γιάννης Κοντάκης,  Δημήτρης Βουράκης

Προσθήκη σχολίου

Η διεύθυνση mail σας ΔΕ θα εμφανιστεί